View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_75 (Length: 221)
Name: NF14614_low_75
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_75 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 14 - 135
Target Start/End: Original strand, 3472570 - 3472691
Alignment:
| Q |
14 |
cagagagagtgcattttaatttaatgtttgaattatgtgaaacaattgaaagatgatattgaagaatgaaattggtagagtgattgatgatacctaggga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3472570 |
cagagagagtgcattttaatttaatgtttgaattatgtgaaacaattgaaagatgatattgaagaatgaaattggtagagtgattgatgatacctaggga |
3472669 |
T |
 |
| Q |
114 |
gagaggagaaggtgggcatggt |
135 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3472670 |
gagaggagaaggtgggcatggt |
3472691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University