View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14614_low_76 (Length: 219)
Name: NF14614_low_76
Description: NF14614
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14614_low_76 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 43381346 - 43381145
Alignment:
| Q |
1 |
cattgaatttttgtctttatataagaacatcaattttctggtttgccaatggatgatatgtaccaccatctatatgattttcttaatgattgtgaccttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43381346 |
cattgaatttttgtctttatataagaacatcaattttctggtttgccaatggatgatatgtaccaccatctatatgattttcttaatgattgtgaccttt |
43381247 |
T |
 |
| Q |
101 |
ttaaaataaaaggagtttcaaatgatgccataagtcttaggctcgtccctttctcgcaaagtgttagggttagagattggctacattttatgtgtgcatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43381246 |
ttaaaataaaaggagtttcaaatgatgccataagtcttaggctcatccatttctcgcaaagtgttaggattagagattggctacattttatgtgtgcatg |
43381147 |
T |
 |
| Q |
201 |
at |
202 |
Q |
| |
|
|| |
|
|
| T |
43381146 |
at |
43381145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 6 - 38
Target Start/End: Complemental strand, 43381379 - 43381347
Alignment:
| Q |
6 |
aatttttgtctttatataagaacatcaattttc |
38 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43381379 |
aatttttgtctttatataagaacatcaattttc |
43381347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University