View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14616_high_16 (Length: 355)
Name: NF14616_high_16
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14616_high_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 18 - 342
Target Start/End: Complemental strand, 36866071 - 36865747
Alignment:
| Q |
18 |
ctattaaagttactatacatcatagcctttgattttgttttgatcttaaagattaatcacaataactatagtgaaagggagagtgtaagtcacgttatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36866071 |
ctattaaagttactatacatcatagccttttattttgttttgattttaaagattaatcacaataactatagtgaaagggagagtgtaagtcacgttatga |
36865972 |
T |
 |
| Q |
118 |
ttaattgctaaccattgcccttaatttaaaaccctaagatcaaaacaaaatcaaaggttatgatacttactaatgcagtaagcatatccttctcttttcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36865971 |
ttaattgctaaccattgcccttaatttaaaaccctaagatcaaaacaaaatcaaaggttatgatacttactaatgcagtaagcatatccttctcttttcc |
36865872 |
T |
 |
| Q |
218 |
tttattatcttccctctcttcatgcaccccttcagtttttcacggttaccaattgctgccagcaacattggttttaatattttctcatgattccaatgtg |
317 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36865871 |
tttattatcttccctctcttcttgcaccccttcagtttttcacggttaccaattgctgccaccaacattggttttaatattttctcatgattccaatgtg |
36865772 |
T |
 |
| Q |
318 |
tattgactgtgctatgcttcatctc |
342 |
Q |
| |
|
||||||||||||| |||||| |||| |
|
|
| T |
36865771 |
tattgactgtgctgtgcttcctctc |
36865747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University