View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14616_high_17 (Length: 336)
Name: NF14616_high_17
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14616_high_17 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 14 - 336
Target Start/End: Complemental strand, 34477866 - 34477544
Alignment:
| Q |
14 |
tctgaaacttcgtagtgtgatcaatgatggtactactactacttgagaaagagaagaagaaaaccgggtggacgagttgttggggcgaaccaaaatgaaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34477866 |
tctgaaacttcgtagtgtgatcaatgatggtactactactacttgagaaagagaagaagaaaaccgggtggacgagttgtcggggcgaaccaaaatgaaa |
34477767 |
T |
 |
| Q |
114 |
gcttttgagaatggatgttgttttgtttgttgataatgttgttggtcataatttccattaagcaaagggaagaagaacgtttgaaaggggttaaagggga |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34477766 |
gcttttgagaatggatgttgttttgtttgttgataatgttgttggtcataatttccattaagcaaagggaagaagaacgtttgaaaggggttaaagggga |
34477667 |
T |
 |
| Q |
214 |
agtagattaatgtgaaaacatccacattttcttcttgatggtattaagttcaaccatttttacgtaggaaaagacaaaatcaagtacaggaattttatga |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34477666 |
agtagattaatgtgaaaacatccacattttcttcttgatggtattgagttcaaccatttttacgtaggaaaagacaaaatcaagtacaggaattttatga |
34477567 |
T |
 |
| Q |
314 |
atttttagagtgaggtttaactc |
336 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34477566 |
atttttagagtgaggtttaactc |
34477544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University