View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14616_high_28 (Length: 248)
Name: NF14616_high_28
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14616_high_28 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 25 - 235
Target Start/End: Complemental strand, 44988396 - 44988186
Alignment:
| Q |
25 |
cggagattaggttaagttgttaaagagaagttgaaagggaaagagtgtgatgagaaagcatacaatgggttgggtcatgaccctttgaactttggtactc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44988396 |
cggagattaggttaagttgttaaagagaaattgaaagggaaagagtgtgatgagaaagcatacaatgggttgggtcatgaccctttgaactttggtactc |
44988297 |
T |
|
| Q |
125 |
gccatggcagcaggtgagggtgtgcggacgatgaaggtttggagagacgatgagagctaaaccctagaaattgaacgaaagaattactcagaagaactga |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
44988296 |
gccatggcagcaggtgagggtgtgcggacgatgaaggtttggagagacgatgagagctaaaccctagaaattgagcgaaagaattactcagaagaactga |
44988197 |
T |
|
| Q |
225 |
cttagtattat |
235 |
Q |
| |
|
||||||||||| |
|
|
| T |
44988196 |
cttagtattat |
44988186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 62 - 198
Target Start/End: Complemental strand, 30882013 - 30881877
Alignment:
| Q |
62 |
ggaaagagtgtgatgagaaagcatacaatgggttgggtcatgaccctttgaactttggtactcgccatggcagcaggtgagggtgtgcggacgatgaagg |
161 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||||||| ||||| ||||||||||| |||||||||||||| |||||||||| ||||||| |||||| |
|
|
| T |
30882013 |
ggaaagagtgtgttgagaaagcgtacaatgggttgggtcataaccctctgaactttggtgctcgccatggcagctggtgagggtgagcggacggtgaagg |
30881914 |
T |
|
| Q |
162 |
tttggagagacgatgagagctaaaccctagaaattga |
198 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30881913 |
tttggagagacgatgagagctaaaccctaaaaattga |
30881877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University