View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14616_high_30 (Length: 242)
Name: NF14616_high_30
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14616_high_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 52380582 - 52380810
Alignment:
| Q |
1 |
cctttgaacacgcatagttactaaacttctatggcgagtttgcttcgtaccaattccttactcacacgctctctattcgccgctcaggtacactttcgtc |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| || |
|
|
| T |
52380582 |
cctttgaacccgcatagttactaaacttctatggcgagtttgcttcgtaccaattccttactcacacgctctctattcgccgctcaggtacgctttcttc |
52380681 |
T |
 |
| Q |
101 |
ccctactgattttgttt------ttgcacagtgatcacgatcatactaatttatttttctgtgtgtgcagggtattaaactaggactatcttccacttct |
194 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52380682 |
ccctactgattttgtttttgcagttgcacagtgatcacgatcatactaatttatctttctgtgtgtgcagggtgttaaactaggactatcttccacttct |
52380781 |
T |
 |
| Q |
195 |
aagattttgcacttttcatccaaaggttc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
52380782 |
cagattttgcacttttcatccaaaggttc |
52380810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University