View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14616_high_35 (Length: 205)
Name: NF14616_high_35
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14616_high_35 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 68; Significance: 1e-30; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 68; E-Value: 1e-30
Query Start/End: Original strand, 130 - 205
Target Start/End: Complemental strand, 47917294 - 47917219
Alignment:
| Q |
130 |
gaagcgaggcttggtaccgatatgggcttagaacagcagcaggtatcgtaatcttccttgttagtggcctctattg |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
47917294 |
gaagcgaggcttggtaccgatatgggcttagaacagcagcaggtatcttaatcttccttgttagtggcctccattg |
47917219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 17 - 64
Target Start/End: Complemental strand, 47917407 - 47917360
Alignment:
| Q |
17 |
caaaatgatcattcataataaaggggaaatgcatgattttgatcacta |
64 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47917407 |
caaaatggtcattcataataaaggggaaatgcatgattttgatcacta |
47917360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 8e-20; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 135 - 200
Target Start/End: Original strand, 29919985 - 29920050
Alignment:
| Q |
135 |
gaggcttggtaccgatatgggcttagaacagcagcaggtatcgtaatcttccttgttagtggcctc |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| | | ||||||||||||||||||| |
|
|
| T |
29919985 |
gaggcttggtaccgatatgggctgagaacagcagcaggtatcttcaacttccttgttagtggcctc |
29920050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 53929 - 53965
Alignment:
| Q |
140 |
ttggtaccgatatgggcttagaacagcagcaggtatc |
176 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
53929 |
ttggtaccgatatgggctgagaacagcagaaggtatc |
53965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University