View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14616_low_27 (Length: 282)
Name: NF14616_low_27
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14616_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 19 - 267
Target Start/End: Complemental strand, 32582553 - 32582305
Alignment:
| Q |
19 |
gttacgtaacgaattagaacaagttctggcgcatgttgagaatcaccgtaacgatgaagatgcagcgtcgagttgtggaagtaaccaccatgtcaaggag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582553 |
gttacgtaacgaattagaacaagttctggcgcatgttgagaatcaccgtaacgatgacgatgcagcgtcgagttgtggaagtaaccaccatgtcaaggag |
32582454 |
T |
|
| Q |
119 |
gaggtggtggtggaagaagcgtcatcgccggtggttgggaagttgtgcagcggttgtggagaaagggagtcagtagtgctgttactgccatgtaggcatt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32582453 |
gaggtggtggtggaagaagcgtcatcgccggtggttgggaagttgtgcagcggttgtggggaaagggagtcagtagtgctgttactgccatgtaggcatt |
32582354 |
T |
|
| Q |
219 |
tgtgtttgtgtacaatgtgtgggacccacattcgtaattgccccctttg |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
32582353 |
tgtgtttgtgtacaatgtgtgggacccacattcgtaattgccctctttg |
32582305 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University