View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14616_low_30 (Length: 271)
Name: NF14616_low_30
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14616_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 231
Target Start/End: Complemental strand, 30224962 - 30224743
Alignment:
| Q |
13 |
gaacgcctttatcttcaccaaagcccgcctgtaaggaccgaaacataacaaaattcaaggccccaaaacaataaaaagtaaaagacaacgcaaactacta |
112 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
30224962 |
gaacgcctttatcttcaccaaaacccgccggtaaggaccgaaacataacaaaattcaaggccccacaacaataaaaagtaaaagacaatgcaaactacta |
30224863 |
T |
 |
| Q |
113 |
agagaaaaataattaacatgctaccaaaattaaatcca-cacacaccacaccctatccaactgaaatatgtgatcattcacacaaaaattaagtgaattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30224862 |
agagaaaaataattaacatgctaccaaaattaaatccaccacacaccacaccctatccaactgaaatatgtgatcattcacacaaaaattaagtgaattt |
30224763 |
T |
 |
| Q |
212 |
gttacatttattatgatcgc |
231 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
30224762 |
gttacatttattatgatcgc |
30224743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University