View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14616_low_31 (Length: 262)
Name: NF14616_low_31
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14616_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 17 - 257
Target Start/End: Complemental strand, 7473980 - 7473750
Alignment:
| Q |
17 |
aaatcacacttttatcaagtgatcatcattgtgtcgaatttgtgtgaattcattcaacacaagcagaagatgcattccacaaatccattccagtattaag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7473980 |
aaatcacacttttatcaagtgatcatcattg----------gtgtgaattcattcaacacaagcagaagatgcattccacaaatccattccagtattaag |
7473891 |
T |
 |
| Q |
117 |
attaacactgaataaacaattaattagaagctaattgaactaacttaaaatatgtcaatttatataccagaaaatcattgcaatgagcaattaatataac |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
7473890 |
attaacactgaataaacaattaattagaagctaattgaactaacttaaaatatgtcaatttatccaccagaaaatcattgcaaagagcaattaatataac |
7473791 |
T |
 |
| Q |
217 |
aaagataatcagagtaatttttcaactatacaaagtattat |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7473790 |
aaagataatcagagtaatttttcaactatacaaagtattat |
7473750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 69 - 120
Target Start/End: Original strand, 33207802 - 33207853
Alignment:
| Q |
69 |
ttcaacacaagcagaagatgcattccacaaatccattccagtattaagatta |
120 |
Q |
| |
|
|||| ||| |||||||||||||||||| || ||||||||| ||||||||||| |
|
|
| T |
33207802 |
ttcagcaccagcagaagatgcattccataagtccattccaatattaagatta |
33207853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University