View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14616_low_34 (Length: 246)
Name: NF14616_low_34
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14616_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 38 - 238
Target Start/End: Complemental strand, 12552231 - 12552029
Alignment:
| Q |
38 |
aaaattgacgtct--aacacttagtgatggaattagagacgaaattattttttccgtctgtgaaattccgtcgctatctttagagtgatttcaatatcat |
135 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12552231 |
aaaattgacgtctctaacacttagtgatggaattagagacgaaattattttttccgtctctgaaattccgtcgctatctttagagtgatttcaatatcat |
12552132 |
T |
|
| Q |
136 |
tttctacataagaaaaaacaagttaagaaatatacttgtttccaagaactgaatgaaggttgatgataactctttcttcttcatctgtgaatttccctct |
235 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
12552131 |
tttctacataagaaaaaacaagataagaaatatacttgtttccaagaactgaatgaaggttgatgataactctttcttcttcatcagtgaatttccctct |
12552032 |
T |
|
| Q |
236 |
ctt |
238 |
Q |
| |
|
||| |
|
|
| T |
12552031 |
ctt |
12552029 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University