View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14616_low_36 (Length: 241)
Name: NF14616_low_36
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14616_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 75 - 236
Target Start/End: Complemental strand, 4329347 - 4329186
Alignment:
| Q |
75 |
taagtccattaagctagaaccaatgtgggctattattggaatctgccaccagaaagatccaataaactcactagatcatattaaaattaaataattgagt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329347 |
taagtccattaagctagaaccaatgtgggctattattggaatctgtcaccagaaagatccaataaactcactagatcatattaaaattaaataattgagt |
4329248 |
T |
|
| Q |
175 |
atttcattaaaattaaactatgttggtgattacatagtggttttgacagataataagaacat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4329247 |
atttcattaaaattaaactatgttggtgattacatagtggttttgacagataataagaacat |
4329186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University