View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14616_low_37 (Length: 235)
Name: NF14616_low_37
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14616_low_37 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 10 - 220
Target Start/End: Complemental strand, 4308044 - 4307834
Alignment:
| Q |
10 |
aagaaaatcaacaaacatgcataaatagtagttggattatactcaattttagtaatgtttctccattttcaatacaacacaatgattacattctctctta |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4308044 |
aagaaaatcaacaaacatgcataaatagtagttggattatactcaattttagtaatgtttctccattttcaatacaacacaatgattacattctctctta |
4307945 |
T |
 |
| Q |
110 |
tgctcctttttactgcaacaaaccattccatgacaaaagaaaaaacttgctaaataaatatcgcgcaaagtggttttgaaagaaatacatcaatgttggt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4307944 |
tgctcctttttactgcaacaaaccattccatgacaaaagaaaaaacttgctaaataaatatcgcgcaaagtggttttgaaagaaatacatcaatgttggt |
4307845 |
T |
 |
| Q |
210 |
gttggaaatat |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
4307844 |
gttggaaatat |
4307834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University