View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14616_low_5 (Length: 556)
Name: NF14616_low_5
Description: NF14616
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14616_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 25 - 327
Target Start/End: Original strand, 35091913 - 35092215
Alignment:
| Q |
25 |
atatatatctttagcagccaggtcatttgctcatgtggctgactcataaaagcacttccactgaaatttagagcagcatatgttacagttataagctttt |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35091913 |
atatatatctttagcagccaggtcatttgctcatgtggctgactcataaaagcacttccactgaaatttagagcagcatatgttacagttataagctttt |
35092012 |
T |
|
| Q |
125 |
ttatgtgattcaaaatgttattaatcatttgttttctttgtaagtgcaatatggccaagttgaccatatttgttttatgagaatcactttgttagtagaa |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35092013 |
ttatgtgattcaaaatgttattaatcatttgttttctttgtaagtgcaatatggccaagttgaccatatttgttttatgagaatcactttgttagtagaa |
35092112 |
T |
|
| Q |
225 |
tctgagtttgcattccacttagtaagaatcacatgcttcattgggtcagaaatattggcagattcacgtaagcatatgccaatatggttcacacaagatc |
324 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35092113 |
tctgagtttgcattccacttagtaagaatcacatgcttcattgggtcagaaatattggcagattcacgtaagcatatgccaatatggttcacacaagatc |
35092212 |
T |
|
| Q |
325 |
aca |
327 |
Q |
| |
|
||| |
|
|
| T |
35092213 |
aca |
35092215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 413 - 540
Target Start/End: Original strand, 35092296 - 35092428
Alignment:
| Q |
413 |
gttgcattctccaatcaacttttatttggtggcagtactattgcatcagctagtgnnnnnnnnnnnnactctatagtagtcttgcaaagcatcatgc--- |
509 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
35092296 |
gttgcattctccaatcaacttttatttggtggcagtactattgcatcagctagtgttttttctttttactctatagtagtcttgcaaagcatcatgcttt |
35092395 |
T |
|
| Q |
510 |
--tttattttgattctttgttttactagagaat |
540 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
35092396 |
attttattttgattctttgttttactagagaat |
35092428 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University