View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14618_high_4 (Length: 367)
Name: NF14618_high_4
Description: NF14618
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14618_high_4 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 103; Significance: 3e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 257 - 367
Target Start/End: Original strand, 32796753 - 32796863
Alignment:
| Q |
257 |
aaaggctctcagatccaacaacacttggtaattagtggacctacctcatctagtcattcctatagacaacaactgagtctacaagataagaaggaaacaa |
356 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32796753 |
aaaggctctcagatccaacaacacttggtaattagtggacctacctcatctagtcattcctatagacaacaagtgagtctacaagataagaaggaaacaa |
32796852 |
T |
|
| Q |
357 |
gatgcatcagt |
367 |
Q |
| |
|
|||| |||||| |
|
|
| T |
32796853 |
gatggatcagt |
32796863 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University