View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14619_low_3 (Length: 211)
Name: NF14619_low_3
Description: NF14619
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14619_low_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 17 - 193
Target Start/End: Original strand, 43148126 - 43148302
Alignment:
| Q |
17 |
cacagattaaacaaccagaatttagtcatgcttaatgagtgagtatgaaggaagtgaggttcctgtcgtgattcaatttattctcaatcacaacggcttg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43148126 |
cacagattaaacaaccagaatttagtcatgcttaatgagtgagtatgaaggaagtgaggttcctgtcgtgattcaatttattctcaatcacaacggcttg |
43148225 |
T |
 |
| Q |
117 |
aaaaatgttaggaacggaattggaagtagaaatgataaggcggtagatggcgtcttcagcaagggcaagacgagatt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43148226 |
aaaaatgttaggaacggaattggaagtagaaatgataaggcggtagatggcgtcttcagcaagggcaagacgagatt |
43148302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University