View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1461_high_15 (Length: 298)
Name: NF1461_high_15
Description: NF1461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1461_high_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 278; Significance: 1e-155; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 278; E-Value: 1e-155
Query Start/End: Original strand, 7 - 288
Target Start/End: Complemental strand, 50254078 - 50253797
Alignment:
| Q |
7 |
aataggtgggtgacttcgttagctataggtaatagcttggcgcgtgtgtcagctgagttaactgcgtcgaaggttatgaagctgtcgaggatggaagaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50254078 |
aataggtgggtgacttcgttagctataggtaatagcttggcgcgtgtgtcagctgagttaactgcgtcgaaggttatgaagctgtcgaggatggaagaag |
50253979 |
T |
|
| Q |
107 |
ggaaccattcatcgggggaatggcgagctgcgccataaactttccatggacctccgagacaatcagtctgcttcaaggctttggctaagcttaggccagc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50253978 |
ggaaccattcatcgggggaatggcgagctgcgccataaactttccatggacctccgagacaatcaggctgcttcaaggctttggctaagcttaggccagc |
50253879 |
T |
|
| Q |
207 |
cattcccgttactccaactactagtgctacgggactttgatgcgccatatatcacagtcactgtaaattaatggaacctttg |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50253878 |
cattcccgttactccaactactagtgctacgggactttgatgcgccatatatcacagtcactgtaaattaatggaacctttg |
50253797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 12 - 254
Target Start/End: Complemental strand, 50246936 - 50246694
Alignment:
| Q |
12 |
gtgggtgacttcgttagctataggtaatagcttggcgcgtgtgtcagctgagttaactgcgtcgaaggttatgaagctgtcgaggatggaagaagggaac |
111 |
Q |
| |
|
|||||||||||| || |||||||||||||| |||||| ||||||||||||||||||||||||| || || ||||||| ||| |||||||||||||||||| |
|
|
| T |
50246936 |
gtgggtgacttcattggctataggtaatagtttggcgtgtgtgtcagctgagttaactgcgtcaaatgtgatgaagccgtctaggatggaagaagggaac |
50246837 |
T |
|
| Q |
112 |
cattcatcgggggaatggcgagctgcgccataaactttccatggacctccgagacaatcagtctgcttcaaggctttggctaagcttaggccagccattc |
211 |
Q |
| |
|
||||| || |||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
50246836 |
cattcgtctggggaatggcgagcaccgccgtaaactttccatggacctccgagacaatcaggctgcttcaaggcttcggctaagcttagtccaaccattc |
50246737 |
T |
|
| Q |
212 |
ccgttactccaactactagtgctacgggactttgatgcgccat |
254 |
Q |
| |
|
|||| ||||| || ||||||||||| |||||||||||| |||| |
|
|
| T |
50246736 |
ccgtaactccgacaactagtgctaccggactttgatgctccat |
50246694 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 50 - 238
Target Start/End: Original strand, 27643993 - 27644181
Alignment:
| Q |
50 |
gtgtgtcagctgagttaactgcgtcgaaggttatgaagctgtcgaggatggaagaagggaaccattcatcgggggaatggcgagctgcgccataaacttt |
149 |
Q |
| |
|
|||||||||||||||| || ||||| ||||| ||||||| || ||||||||||| || ||||| | |||| ||| |||||||||| || |||||||| |
|
|
| T |
27643993 |
gtgtgtcagctgagttgacagcgtcaaaggtgatgaagccatcaaggatggaagagggaaaccagccgtcggcggagcggcgagctgcaccgtaaacttt |
27644092 |
T |
|
| Q |
150 |
ccatggacctccgagacaatcagtctgcttcaaggctttggctaagcttaggccagccattcccgttactccaactactagtgctacgg |
238 |
Q |
| |
|
|||||| ||||| |||||||||| |||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
27644093 |
ccatgggcctccaagacaatcaggctgcttcaaggctttggctaggcttagcccagccattcccgttactccaaccactagtgctacgg |
27644181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University