View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1461_high_22 (Length: 238)
Name: NF1461_high_22
Description: NF1461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1461_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 50141215 - 50141434
Alignment:
| Q |
1 |
ttcatcaatcaagtataaagataaatgcccatctatctatcgttgagatgagattatgccgtaggaccataaactaaagctaaatataggcaaaggtgag |
100 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50141215 |
ttcatcaatcaagtgtaaagataaatgcccatctatctatcgttgagatgagattatgccgtaggaccataaactaaagctaaatataggcaaaggtga- |
50141313 |
T |
 |
| Q |
101 |
tgagtggacggtgtgtatgtgagctttgtccttttttgcatacatagataaacatggatattggaattgattgggttaggccatcgctttgttaggttcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50141314 |
---gtggacggtgtgtatgtgagctttgtccttttttgcatacatagataaacatggatattggaattgattgggttaggccatcgctttgttaggttcc |
50141410 |
T |
 |
| Q |
201 |
aaaattatttatctcgtgcatgat |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
50141411 |
aaaattatttatctcgtgcatgat |
50141434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University