View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1461_high_9 (Length: 416)

Name: NF1461_high_9
Description: NF1461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1461_high_9
NF1461_high_9
[»] chr3 (2 HSPs)
chr3 (336-400)||(1257043-1257107)
chr3 (15-49)||(1258536-1258570)


Alignment Details
Target: chr3 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 336 - 400
Target Start/End: Complemental strand, 1257107 - 1257043
Alignment:
336 ccctctattggccctgatatatttggctctggggttgcttggaagcgttttgaattggagcaagg 400  Q
    |||||||| |||| |||||| |||||||||||| |||||||||||||||||||||||||||||||    
1257107 ccctctataggccgtgatatttttggctctgggattgcttggaagcgttttgaattggagcaagg 1257043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 49
Target Start/End: Complemental strand, 1258570 - 1258536
Alignment:
15 gggtgacagggaaatgagttagattaacgtgtacc 49  Q
    |||||||||||||||||||||||||||||||||||    
1258570 gggtgacagggaaatgagttagattaacgtgtacc 1258536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University