View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1461_low_10 (Length: 416)
Name: NF1461_low_10
Description: NF1461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1461_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 49; Significance: 7e-19; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 336 - 400
Target Start/End: Complemental strand, 1257107 - 1257043
Alignment:
| Q |
336 |
ccctctattggccctgatatatttggctctggggttgcttggaagcgttttgaattggagcaagg |
400 |
Q |
| |
|
|||||||| |||| |||||| |||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1257107 |
ccctctataggccgtgatatttttggctctgggattgcttggaagcgttttgaattggagcaagg |
1257043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 15 - 49
Target Start/End: Complemental strand, 1258570 - 1258536
Alignment:
| Q |
15 |
gggtgacagggaaatgagttagattaacgtgtacc |
49 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
1258570 |
gggtgacagggaaatgagttagattaacgtgtacc |
1258536 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University