View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1461_low_15 (Length: 302)
Name: NF1461_low_15
Description: NF1461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1461_low_15 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 253; Significance: 1e-141; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 253; E-Value: 1e-141
Query Start/End: Original strand, 17 - 293
Target Start/End: Original strand, 32510588 - 32510864
Alignment:
| Q |
17 |
aaaatcaatgtgtcacccaaaaattccttttgtgaaccaagaaggtttgattgtacatacaagatggcttgtacttcaaaggtcaaatggggaagaacat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32510588 |
aaaatcaatgtgtcacccaaaaattccttttgtgaaccaagaagctttgattgtacatacaagatggcttgtacttcaaaggtcaaatggggaagaacat |
32510687 |
T |
|
| Q |
117 |
gagccaagacatgttcatcatggtgatggtggtgatagtggcagctccggtgagagtggttctgtgaagcgatgtgtgtgctcgccatctcagcatccag |
216 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
32510688 |
gagccaatacatgttcatcatggtgatggtggtgatagtggcagctccggtgagagtggttctgtgaagcgatgcgtgtgctcgccgtctcagcatccag |
32510787 |
T |
|
| Q |
217 |
ggtcatttcggtgtcgccaacatcatggtgagtatgtttggcgcggtataacaattaagtagctgaattttgatgat |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
32510788 |
ggtcatttcggtgtcgccaacatcatggtgagtatgtttggcgcggtagaacaattaagtagctgaattttaatgat |
32510864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University