View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1461_low_30 (Length: 223)
Name: NF1461_low_30
Description: NF1461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1461_low_30 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 203
Target Start/End: Complemental strand, 30107843 - 30107640
Alignment:
| Q |
1 |
aaaatcctgccataccgttcactttgtggtgct--catatcggattatggcggaaaatccccaatnnnnnnnttgtttgtaatttaacctgtggggcaac |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
30107843 |
aaaatcctgccataccgttcactttgtggtgctgtcatatcggattatggcggaaaatccccaataaaaaa-ttgtttgtaatttaacctgtggggcaac |
30107745 |
T |
 |
| Q |
99 |
ttttgacccccagtatcacttcggatgcacacatgcaggaaaacgtgaattttgtgccgtttggaagtacacttccagaaacaccagtggtgttttaaga |
198 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30107744 |
ttttgacccccagtatcacttcggacgcacacatccaggaaaacgtgaattttgtgccgtttggaagtacacttccagaaacaccagtagtgttttaaga |
30107645 |
T |
 |
| Q |
199 |
aatgt |
203 |
Q |
| |
|
||||| |
|
|
| T |
30107644 |
aatgt |
30107640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University