View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1461_low_31 (Length: 222)
Name: NF1461_low_31
Description: NF1461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1461_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 3e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 11 - 165
Target Start/End: Complemental strand, 36525822 - 36525666
Alignment:
| Q |
11 |
aactttaggtaaattttgagaatatgtttgtcaaaactttgtgctgaatataaactctccatgaatttgtc--nnnnnnnnctctccatgaaaaataaat |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
36525822 |
aactttaggtaaattttgagaatatgtttgtctaaactttgtgctgaatataaactctccatgaatttgtcaaaaaataaactctccatgaaaaataaat |
36525723 |
T |
|
| Q |
109 |
agtaacataagaacagaaattgaataagctttcaatatgatactaacattagcctat |
165 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
36525722 |
agtaacataagaacagaaattgaataacctttcaatatgatactaacgctagcctat |
36525666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 174 - 211
Target Start/End: Complemental strand, 36525263 - 36525226
Alignment:
| Q |
174 |
ttatcctttcattttcttcgtgcacaatctttcttcat |
211 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36525263 |
ttatcctttcattttcttcgtgcataatctttcttcat |
36525226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University