View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1461_low_32 (Length: 216)
Name: NF1461_low_32
Description: NF1461
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1461_low_32 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 141 - 216
Target Start/End: Complemental strand, 16514405 - 16514330
Alignment:
| Q |
141 |
gttgtgctaaagttcattgaaaatgatacagttcaacttgattttacttacccttttctcttttgtttcgttaaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16514405 |
gttgtgctaaagttcattgaaaatgatacagttcaacttgattttacttacccttttctcttttgtttcgttaaat |
16514330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 17 - 90
Target Start/End: Complemental strand, 16514529 - 16514456
Alignment:
| Q |
17 |
atacataccattaggaaaacatttgaggctgctgtcaagttcaagccaacaccaccagcttttagtgacatcaa |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
16514529 |
atacataccattaggaaaacatttgaggctgcagtcaagttcaagcctacaccaccagcttttagtgacatcaa |
16514456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University