View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14620_low_2 (Length: 396)
Name: NF14620_low_2
Description: NF14620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14620_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 6e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 1789158 - 1788926
Alignment:
| Q |
18 |
gaaaacaccctcatactcatcttcaaatataaaaatatatnnnnnnnncaaatgttacaagaaacccttacgtaaaattaaaattaattatgaaatatct |
117 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |||||| | |
|
|
| T |
1789158 |
gaaaaaaccctcatactcatcttcaaatataaaaatatataaaaaaat-aaatgttacaagaaacccttatgtaaaattaaaattaattattaaatattt |
1789060 |
T |
 |
| Q |
118 |
cgtatttttaca-----gatatttaataataattttagtttatctcaatagattgtgtttttccctttatctcaccgaagtgtttagtttatcttagtaa |
212 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1789059 |
cgtatttttacatacgagatatttaataataattttagtttatctcaataggttgtgtttttccctttctctcaccgaagtgtttagtttatcttagtaa |
1788960 |
T |
 |
| Q |
213 |
gcatctcatataaaaatgttgttagcaatcatag |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
1788959 |
gcatctcatataaaaatgttgttagcaatcatag |
1788926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University