View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14620_low_8 (Length: 237)
Name: NF14620_low_8
Description: NF14620
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14620_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 131 - 220
Target Start/End: Complemental strand, 3111011 - 3110922
Alignment:
| Q |
131 |
cattttatctttcaaaaccttgttagtatattctgctgagatggaattagtagtggtagtttgttagaagttagttattcctctctcttg |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3111011 |
cattttatctttcaaaaccttgttagtatattctgctgagatggaattagtagtggtagtttgttagaagttagttattcctctctcttg |
3110922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University