View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14623_high_20 (Length: 297)
Name: NF14623_high_20
Description: NF14623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14623_high_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 19 - 283
Target Start/End: Original strand, 3990693 - 3990957
Alignment:
| Q |
19 |
aaaatttccttcactgctttggtattgaattgtttatagtaagacaactggagactgcaagagttttccccatcaaacaaacatgtttatatattggacg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990693 |
aaaatttccttcactgctttggtattgaattgtttatagtaagacaactggagactgcaagagttttccccatcaaacaaacatgtttatatattggaca |
3990792 |
T |
 |
| Q |
119 |
atcatgtcttctgagccatgtttttaatcttccttcaggtatacgatatttgccactcatatggagaatatagcggaattagcaacaatctatcccaacg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990793 |
atcatgtcttctgagccatgtttttaatcttccttcaggtatacgatatttgccactcatatggagaatatagcggaattagcaacaatctatcccaacg |
3990892 |
T |
 |
| Q |
219 |
tgaaaattctccactttcatgtcgaattaaaaaacaaccatttggagttcaaggtagtatctctg |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3990893 |
tgaaaattctccactttcatgtcgaattaaaaaacaaccatttggagttcaaggtagtatctctg |
3990957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University