View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14623_high_39 (Length: 210)
Name: NF14623_high_39
Description: NF14623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14623_high_39 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 124 - 192
Target Start/End: Complemental strand, 39416555 - 39416487
Alignment:
| Q |
124 |
gttacccagaaagtgaagtgtttcttcacacgatgcagctcctaannnnnnngcttcgattttgatttt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39416555 |
gttacccagaaagtgaagtgtttcttcacacgatgcagctcctaatttttttgcttcgattttgatttt |
39416487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 16 - 60
Target Start/End: Complemental strand, 39416663 - 39416619
Alignment:
| Q |
16 |
gaactaagacgaaattgcgatgttctgttctgttcatatatgaat |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39416663 |
gaactaagacgaaattgcgatgttctgttctgttcatatatgaat |
39416619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University