View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14623_low_11 (Length: 379)
Name: NF14623_low_11
Description: NF14623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14623_low_11 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 13 - 202
Target Start/End: Original strand, 50635492 - 50635681
Alignment:
| Q |
13 |
aagcgcggttagttgttcagtgaaaatgggatctgaagctgctatggctccggaatgggcatcggaggcttgcataatgggaatcgacgaagctggaaga |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50635492 |
aagcgcggttagttgttcagtgaaaatgggatctgaagctgctatggctccggaatgggcatcggaggcttgcataatgggaatcgacgaagctggaaga |
50635591 |
T |
|
| Q |
113 |
ggtcctgttcttggtcctatggtctatggttgtttatactgtcctcgctcctaccaaaaaaccctttctactttgagtttcgcaggtagg |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50635592 |
ggtcctgttcttggtcctatggtctatggttgtttatactgtcctcgctcctaccaaaaaaccctttctactttgagtttcgcaggtagg |
50635681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 5e-47
Query Start/End: Original strand, 251 - 362
Target Start/End: Original strand, 50635726 - 50635837
Alignment:
| Q |
251 |
cattgccagatctttgaattttaattattatttttgcaaattcattagttttggcttctttaaaatcggtgtgtttggtgtctgaaatggcactacacat |
350 |
Q |
| |
|
|||||||| | ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50635726 |
cattgccatagctttgaattttaattataatttttgcaaattcattagttttggcttctttaaaataggtgtgtttggtgtctgaaatggcactacacat |
50635825 |
T |
|
| Q |
351 |
gtggttatattc |
362 |
Q |
| |
|
|||||||||||| |
|
|
| T |
50635826 |
gtggttatattc |
50635837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University