View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14623_low_13 (Length: 356)
Name: NF14623_low_13
Description: NF14623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14623_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 337
Target Start/End: Original strand, 15964802 - 15965149
Alignment:
| Q |
1 |
tacataaagctaatcagtgatgattggccagctcttagtcgcatattatagtatgctagatttaagtgttcatcactttgatatgattttttcaaggggt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
15964802 |
tacataaagctaatcagtgatgattggccagctcttcgtcgcatattatagtatgctagatttaagtgttcatcactttgatgtgattttttcaaggggt |
15964901 |
T |
|
| Q |
101 |
ttggatttgaattttgtggtcatttgtgatggagttggaggcttttagcttattatttggatgctgctggtttaagggggttttgttgggttttggtgta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15964902 |
ttggatttgaattttgtggtcatttgtgatggagttggaggcttttagcttattatttggatgctgctggtttaagggggttttgttgggttttggtgta |
15965001 |
T |
|
| Q |
201 |
ggctttggagg------------nnnnnnnnattggtgttgatgatagccattgtggaattgtgtctttattggtgtttatgatgtacgatatatgtgtt |
288 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
15965002 |
ggctttggaggtttttttttctttttctttaattggtgttgatgatagccgttgtggaattgtgtctttattgatgtttatgatgtacgatatatgtgtt |
15965101 |
T |
|
| Q |
289 |
ttcttctaggtgtttcgactatgtacgacaccttttgatatgtagtttc |
337 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
15965102 |
ttcttctaggtgtttcgactatgtacga-accttttgatatgtagtttc |
15965149 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 248 - 299
Target Start/End: Original strand, 40796743 - 40796794
Alignment:
| Q |
248 |
ttgtgtctttattggtgtttatgatgtacgatatatgtgttttcttctaggt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||| ||||| |
|
|
| T |
40796743 |
ttgtgtctttattggtgtttatgatgtacgatgtatgtattttcttttaggt |
40796794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 248 - 277
Target Start/End: Complemental strand, 536690 - 536661
Alignment:
| Q |
248 |
ttgtgtctttattggtgtttatgatgtacg |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
536690 |
ttgtgtctttattggtgtttatgatgtacg |
536661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University