View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14623_low_32 (Length: 250)
Name: NF14623_low_32
Description: NF14623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14623_low_32 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 4 - 232
Target Start/End: Original strand, 37443896 - 37444124
Alignment:
| Q |
4 |
ctcgaacaatatcctagaaacggactccttcttcctagtcccgatttccatagactctgcctccaacaacttcaactctttcgaagaattgttcccgaat |
103 |
Q |
| |
|
|||||| || ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37443896 |
ctcgaaaaacatcctagaaacggactcgttcttcctagtcccgatttccatagactctgcctccaacaacttcaactctttcgaagaattgttcccgaat |
37443995 |
T |
 |
| Q |
104 |
cgttcttatcggttcgtagtttgtacttcatattatctaataaattagggttttgattgataaattgctgaacggtgtcgtttttgttgtgttgtgcagg |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37443996 |
cgttcttatcggttcgtagtttgtacttcatattatctgataaattagggttttgattgataaattgctgaacggtgtcgtttttgttgtgttgtgcagg |
37444095 |
T |
 |
| Q |
204 |
tgtatgttagacctgcaggtagttatgtg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
37444096 |
tgtatgttagacctgcaggtagttatgtg |
37444124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University