View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14623_low_34 (Length: 235)
Name: NF14623_low_34
Description: NF14623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14623_low_34 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 35625667 - 35625443
Alignment:
| Q |
1 |
aactatattgaatccttttaagaatgttgctcatattagtcttccacccctcaatagtgcttataaaagttcttgctatgttgtgaaaaaggttactctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35625667 |
aactatattgaatccttttaagaatgttgctcatattagtcttccacccctcaataatgcttataaaagttcttgctatgttgtgaaaaaggttactctt |
35625568 |
T |
|
| Q |
101 |
tctgctgaccctataataagaccaaatgattacgtggttctagcaatccacaaatcttctagtcttgcttttataaaagcaggccaaacatgttggac-- |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35625567 |
tctgctgaccctataataagaccaaatgattacgtggttctagcaatccacaaatcttctagtcttgcttttataaaagcaggccaaacatgttggactt |
35625468 |
T |
|
| Q |
199 |
-ttatataagaaactgtttattctt |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
35625467 |
attatataagaaactgtttattctt |
35625443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 90 - 132
Target Start/End: Complemental strand, 35629290 - 35629248
Alignment:
| Q |
90 |
aggttactctttctgctgaccctataataagaccaaatgatta |
132 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35629290 |
aggtcactctttctgctgaccctataacaagaccaaatgatta |
35629248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 5 - 52
Target Start/End: Complemental strand, 35629375 - 35629328
Alignment:
| Q |
5 |
atattgaatccttttaagaatgttgctcatattagtcttccacccctc |
52 |
Q |
| |
|
|||||| |||||| |||||||||||||| ||||||||||||| ||||| |
|
|
| T |
35629375 |
atattgcatccttctaagaatgttgctcctattagtcttccaaccctc |
35629328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University