View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14623_low_37 (Length: 223)
Name: NF14623_low_37
Description: NF14623
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14623_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 17 - 205
Target Start/End: Original strand, 302085 - 302274
Alignment:
| Q |
17 |
aatattgtatccatattctggtgtgcatatttgtcattttacaatagactgatcttccagcttaagcaaatccttgttcaaatttta--atgtcttttta |
114 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
302085 |
aatattgtatccatattctggtgtgaatatttgtcattttacaatagactgatcttccagcttcagcaaatccttgttcaaattttaatatgtcttttta |
302184 |
T |
|
| Q |
115 |
caaattttctttttgaaatagttgcatcctttataaaattttgattgattccaagggcagtgtctttcttgtgttccgggtatatattatg |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
302185 |
caaattttctttttgaaatagttgcatcctttataaaaaatttattgattccaa-ggcagtatctttcttgtgttccgggtatatattatg |
302274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University