View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14624_high_4 (Length: 248)
Name: NF14624_high_4
Description: NF14624
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14624_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 93; Significance: 2e-45; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 16 - 172
Target Start/End: Original strand, 35895120 - 35895275
Alignment:
| Q |
16 |
aatatcgagcgtgaactcccaccgagtactaggtagggaatgaacaattttgaaaggcagaaaaatannnnnnnnnatcaagaagcttaatatcataact |
115 |
Q |
| |
|
|||||||||||||||||||||| || || |||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
35895120 |
aatatcgagcgtgaactcccactaggttctgggtagggaatgaacaattttaaaaggcagaaaaataattttctt-atcaagaagcttaatatcataact |
35895218 |
T |
|
| Q |
116 |
tatctactcatcgccgttgtcatttgccaacgagatatgaggatcttagtatgcaat |
172 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35895219 |
tatctactcatcgccattgtcatttgccaacgagatatgaggatcgtagtatgcaat |
35895275 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 82
Target Start/End: Original strand, 33270104 - 33270136
Alignment:
| Q |
50 |
agggaatgaacaattttgaaaggcagaaaaata |
82 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
33270104 |
agggaatgaacaattttgaaaggaagaaaaata |
33270136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University