View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14625_high_11 (Length: 440)
Name: NF14625_high_11
Description: NF14625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14625_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 6e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 199 - 374
Target Start/End: Complemental strand, 5935214 - 5935039
Alignment:
| Q |
199 |
ttcatgttgttacagccagaccacaatatatcaggaccatttgatttgaatcaatgactaagattataaaactaatgtgtaacctggattgtccgatctc |
298 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| ||||||||| |
|
|
| T |
5935214 |
ttcatgttgttacagccagacaacaatatatcaggaccatttgatttgaatcaatgactaagattataaaattaatgtgtaatttggattatccgatctc |
5935115 |
T |
 |
| Q |
299 |
atatcaatgatcgtgattgaataatgtataaaaccgtgtgtttttctatagcaacaaaaccacatccgtaactcta |
374 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
5935114 |
atatcaatgatcgtgattgaataatgtataaaaccgtatgtttttttatagcaacaaaaccacatccgtaactcta |
5935039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 33 - 69
Target Start/End: Complemental strand, 23629374 - 23629338
Alignment:
| Q |
33 |
tatgtttggctttcaaaaatttaaattgattatggag |
69 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
23629374 |
tatgtttggctttcaaaaaggtaaattgattatggag |
23629338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University