View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14625_high_28 (Length: 263)
Name: NF14625_high_28
Description: NF14625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14625_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 26 - 247
Target Start/End: Complemental strand, 3625893 - 3625682
Alignment:
| Q |
26 |
gccatgaggggatacgcaccaccacgccattgaaggatgaatgctatggtctgtgacat-gaggagagtatgaatgaatcatggagtgattggagtggag |
124 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||||||| ||||||||||| |||||||||| ||||||||||||||| ||| |
|
|
| T |
3625893 |
gccatgaggggatacgtaccaccacgtcattgaaggatgaatgctattgtctgtgacattgaggagagtaagaatgaatcatggag-----------gag |
3625805 |
T |
 |
| Q |
125 |
ccacatgttttacttccttcattttcctttttgaaaacaagcattttggactaaaaattacttcatccatccttaatcatagaccccttttttcttgttt |
224 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
3625804 |
tcacatgttttacttctttcattttcctttttggaaacaagcattttggactaaaaattacttcatacatccttaatcatagacccgttttttcttgttt |
3625705 |
T |
 |
| Q |
225 |
taattaaggtgacaactacatcc |
247 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3625704 |
taattaaggtgacaactacatcc |
3625682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 5 - 34
Target Start/End: Complemental strand, 3627013 - 3626984
Alignment:
| Q |
5 |
gacaagcagaagaatgagggagccatgagg |
34 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3627013 |
gacaagcagaagaatgagggagccatgagg |
3626984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University