View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14625_high_30 (Length: 251)
Name: NF14625_high_30
Description: NF14625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14625_high_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 18 - 154
Target Start/End: Original strand, 44866008 - 44866144
Alignment:
| Q |
18 |
caattttgccggttccggcgcctttttcagcgccaccgggattttttccttaagcgacggcgtttcagatagatgcataagtatatactttcgcaaacca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44866008 |
caattttgccggttccggcgcctttttcagtgccaccgggattttttcctcaagcgacggcgtttcagatagatgcataagtatatactttcgcaaacca |
44866107 |
T |
|
| Q |
118 |
cggctattcatagttttgcacagacagtgaggctcac |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44866108 |
cggctattcatagttttgcacagacagtgaggctcac |
44866144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University