View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF14625_high_30 (Length: 251)

Name: NF14625_high_30
Description: NF14625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF14625_high_30
NF14625_high_30
[»] chr3 (1 HSPs)
chr3 (18-154)||(44866008-44866144)


Alignment Details
Target: chr3 (Bit Score: 129; Significance: 7e-67; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 18 - 154
Target Start/End: Original strand, 44866008 - 44866144
Alignment:
18 caattttgccggttccggcgcctttttcagcgccaccgggattttttccttaagcgacggcgtttcagatagatgcataagtatatactttcgcaaacca 117  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
44866008 caattttgccggttccggcgcctttttcagtgccaccgggattttttcctcaagcgacggcgtttcagatagatgcataagtatatactttcgcaaacca 44866107  T
118 cggctattcatagttttgcacagacagtgaggctcac 154  Q
    |||||||||||||||||||||||||||||||||||||    
44866108 cggctattcatagttttgcacagacagtgaggctcac 44866144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University