View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14625_high_32 (Length: 243)
Name: NF14625_high_32
Description: NF14625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14625_high_32 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 22 - 243
Target Start/End: Original strand, 31695840 - 31696061
Alignment:
| Q |
22 |
atattccatacttaatttagtgtaataatctttattttgatattaaagttttgtagcatatacaaagatcaatccgaatattgaaccaagttgagtcaag |
121 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31695840 |
atattccatacttaatttagggtaataatctttattttgatattaaagttttgtagcatatgcaaagatcaatccgaatattgaaccaagttgagtcaag |
31695939 |
T |
 |
| Q |
122 |
ttgttgacaatcaaagtgccgggtcagacaccatgacatcgaagtcattgactatagttgcaaaaaatactacagactattcggtaatattaaaccacgt |
221 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | || |
|
|
| T |
31695940 |
ttgttgacaatcaaagtgccgggtaagacactatgacatcgaagtcattgactatagttgcaaaaaatactacagactattcggtaatattaaactatgt |
31696039 |
T |
 |
| Q |
222 |
atttcgtcatctaataattgta |
243 |
Q |
| |
|
||||| |||||||||||||||| |
|
|
| T |
31696040 |
atttcttcatctaataattgta |
31696061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University