View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14625_high_38 (Length: 231)
Name: NF14625_high_38
Description: NF14625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14625_high_38 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 15234157 - 15234371
Alignment:
| Q |
1 |
ttaaaattaccatgttcaatcaaccatggttctggattgttgatgtcattattggaatgagaagatatccatttgagtgcagcccaacaatcatggtaac |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15234157 |
ttaaaattaccatgttcgatcaaccatggttctggattgttgatgttattattggaatgagaagatatccatttgagtgcagcccaacaatcatggtaac |
15234256 |
T |
 |
| Q |
101 |
atgtagggagaggatactcaggagcaagactatattcaatggaaacaattatcacatttgcttgtgatgcaaaggttttcaaatggtcatggtacttctt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15234257 |
atgtagggagaggatactcaggagcaagactatattcaatggaaacaattatcacatttgcttgtgatgcaaaggttttcaaatgttcatggtacttctt |
15234356 |
T |
 |
| Q |
201 |
cgagaatgttgattc |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
15234357 |
cgagaatgttgattc |
15234371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 3 - 208
Target Start/End: Complemental strand, 17473373 - 17473159
Alignment:
| Q |
3 |
aaaattaccatgttcaatcaaccatggttctggattgttgatg---tcatt------attggaatgagaagatatccatttgagtgcagcccaacaatca |
93 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17473373 |
aaaatcaccatgttcaatcaaccatggttctgcattgttgatggtatcattggtatgattggaatgagaagatacccatttgagtgcagcccaacaatca |
17473274 |
T |
 |
| Q |
94 |
tggtaacatgtagggagaggatactcaggagcaagactatattcaatggaaacaattatcacatttgcttgtgatgcaaaggttttcaaatggtcatggt |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
17473273 |
tggtaacatgtagggagaggatactcaggagcaagtctatattcaattgaaacaacaatcacatttgcttgtgatgcaaagattttcaaatggtcatggt |
17473174 |
T |
 |
| Q |
194 |
acttcttcgagaatg |
208 |
Q |
| |
|
|| ||| ||||||| |
|
|
| T |
17473173 |
acaactttgagaatg |
17473159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University