View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14625_low_18 (Length: 342)
Name: NF14625_low_18
Description: NF14625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14625_low_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 85 - 327
Target Start/End: Original strand, 27197824 - 27198066
Alignment:
| Q |
85 |
ctcactgcattatttaaatagttcatatttcatttttgagttttataatcattatacatatatcacaaccttatatgactccagactttctcttgaggtg |
184 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27197824 |
ctcactacattatttaaatagttcatatttcatttttgagttttataatcattatacatatatcacaaccttatatgactctagactttctcttgaggtg |
27197923 |
T |
 |
| Q |
185 |
attcttgatattgtttttctaccaatgtcgatgaaaatcaattcaaaaataagatcgaatgaagcatttgtaggatttaagtattagttattgatgtatt |
284 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| |||||||| |||||||||||||||||||||| ||| |
|
|
| T |
27197924 |
attcttgatattgtttttctatcaatgtcgatgaaaatcaattcaaaaataagatcacatgaaggatttgtagaatttaagtattagttattgatgaatt |
27198023 |
T |
 |
| Q |
285 |
gtttgttggactttattttttaatggaccgtaatgttcaatga |
327 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27198024 |
gtttgttggactttatttttgaatggaccgtaatgttcaatga |
27198066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University