View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14625_low_22 (Length: 325)
Name: NF14625_low_22
Description: NF14625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14625_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 7e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 7e-80
Query Start/End: Original strand, 22 - 180
Target Start/End: Complemental strand, 46866155 - 46865997
Alignment:
| Q |
22 |
gagttaacttacgctaagttattttgttggaaatgagccaaaaatgttatgagaagtgtcgtacccttagatttttagtcatagctcaatgcacctaaaa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46866155 |
gagttaacttacgctaagttattttgttgggaatgagccaaaaatattatgagaagtgtcgtacccttagatttttagtcatagctcaatgcacctaaaa |
46866056 |
T |
|
| Q |
122 |
tctttgtttttgataaaatggagtcgtttgattcatttcaatattaaacaaataaaaaa |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46866055 |
tctttgtttttgataaaatggagtcgtttgattcatttcaatattaaacaaataaaaaa |
46865997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 181 - 304
Target Start/End: Original strand, 11335140 - 11335263
Alignment:
| Q |
181 |
ggataatgctgaatggtacgggattgttggctacgaaaaatgacgaatgcttaattgcttattttcaatgcaaaaatccatgtattcacattacatttgc |
280 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
11335140 |
ggataatgttgaatggtacgggattgttggctacgaaaaatgacgaatgcttaattgcttattttcaatgcataaatccatgtattcacattatatttgc |
11335239 |
T |
|
| Q |
281 |
taacaatttcattgccactacccc |
304 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
11335240 |
taacaatttcattgccactacccc |
11335263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 226 - 304
Target Start/End: Original strand, 11052746 - 11052824
Alignment:
| Q |
226 |
aatgcttaattgcttattttcaatgcaaaaatccatgtattcacattacatttgctaacaatttcattgccactacccc |
304 |
Q |
| |
|
||||||||||||| |||||| |||||| | |||||||||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
11052746 |
aatgcttaattgcgtatttttaatgcatagatccatgtattcacattatatttgttaacaatttcattgccacaacccc |
11052824 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University