View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14625_low_24 (Length: 316)
Name: NF14625_low_24
Description: NF14625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14625_low_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 20 - 297
Target Start/End: Original strand, 15288634 - 15288911
Alignment:
| Q |
20 |
aaacagagcttggttccaactcagcaactccaccagcaccatctttagtggtattgttcttcggaaaaggtttctcgaaagcgaaaaacctcttcaacct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288634 |
aaacagagcttggttccaactcagcaactccaccagcaccatctttagtggtattgttcttcggaaaaggtttctcgaaagcgaaaaacctcttcaacct |
15288733 |
T |
 |
| Q |
120 |
ccatttcgaaactggttcatttcgaaccagttccgtagtggctttctctgaatctatgtcaatcggttggatcttcaacggagccattaatcttcttctc |
219 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288734 |
ccacttcgaaactggttcatttcgaaccagttccgtagtggctttctctgaatctatgtcaatcggttggatcttcaacggagccattaatcttcttctc |
15288833 |
T |
 |
| Q |
220 |
aaacaacaaaaatgctagctttaaattgaagagtcaaaattacaagctagtcaacaaagtcaataactcatagtcaca |
297 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15288834 |
aaacaagaaaaatgctagctttaaattgaagagtcaaaattacaagctagtcaacaaagtcaataactcatagtcaca |
15288911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University