View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14625_low_31 (Length: 269)
Name: NF14625_low_31
Description: NF14625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14625_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 18444683 - 18444430
Alignment:
| Q |
1 |
catatatgtcagatgataggtgagtttttgggttattgcattggagtttagaactattaatggagatgttcactgcttagtccatattttttaatcaaac |
100 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
18444683 |
catatatgtcagatgattggtgagattttgggttattgcattggagtttagaactattaatggagatgttcaatgcttagtccatattttttaatcaaac |
18444584 |
T |
 |
| Q |
101 |
taaagaaattaaagttgaaattgttccttacattaaatgtattatatttgtgtgtgatacgtcatgtgtatttttctgtgacggaaacccatattggtat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18444583 |
taaagaaattaaagttgaaattgttccttacattaaatgtattatatttgtgtatgatatgtcatgtgtatttttctgtgaccgaaacccatattggtat |
18444484 |
T |
 |
| Q |
201 |
cctcaactggtgttgttgatttacatgagaattgattctcaaaaatcttgtttg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18444483 |
cctcaactggtgttgttgatttacatgagaattgattctcaaaaatcttgtttg |
18444430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University