View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14625_low_47 (Length: 213)
Name: NF14625_low_47
Description: NF14625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14625_low_47 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 52 - 193
Target Start/End: Complemental strand, 44952152 - 44952015
Alignment:
| Q |
52 |
attcccgtgttcttatccgtacgtagaccgtggttgccacactcttaacaattatggtaaagcttatatcatgcatttgtgaggagtccacacgcatttc |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44952152 |
attcccgtgttcttatccgtacgtagaccgtggttgccacactcttaacaaatatggtaaagcttatatcatgcatttgtgaggagtccacacgcatttc |
44952053 |
T |
|
| Q |
152 |
ccagttttgtagtatcttaattgattgaccaatcaccatgat |
193 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44952052 |
ccagttttgtagtatc----ttgattgaccaatcaccatgat |
44952015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University