View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14625_low_49 (Length: 206)
Name: NF14625_low_49
Description: NF14625
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14625_low_49 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 5e-61; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 5e-61
Query Start/End: Original strand, 12 - 206
Target Start/End: Complemental strand, 40618532 - 40618335
Alignment:
| Q |
12 |
ctcattgtact-ttcttctttagacacatcttatgtgttaac---tgggatgatttattgttttatatattgcatttgacttcttcnnnnnnnnnctttt |
107 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40618532 |
ctcattgtactgttcttctttagacacatcttgtgtgttaataattgggatgatttattgttttatatattgcatttgacttctt--aaaaaaaactttt |
40618435 |
T |
 |
| Q |
108 |
attttactatgggtgtttcggttaaaaattaaaatagat-atgtattttttcttaacggaacaataaatatattttagaaacaaaggagaaaagcgcaac |
206 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40618434 |
attttactatgggtgtttgggttaaaaattaaaatagattatgtattttttcttaacggaacaataaatatattttagaaacaaaggagaaaagcacaac |
40618335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 48 - 93
Target Start/End: Complemental strand, 16125564 - 16125519
Alignment:
| Q |
48 |
ttaactgggatgatttattgttttatatattgcatttgacttcttc |
93 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
16125564 |
ttaactgggacattttattgttttatatattgcatttgacttcttc |
16125519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University