View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14626_low_15 (Length: 243)
Name: NF14626_low_15
Description: NF14626
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14626_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 63; Significance: 2e-27; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 157 - 231
Target Start/End: Complemental strand, 14308728 - 14308654
Alignment:
| Q |
157 |
aatttttggacaggaggataatccttctataatttgtctctttcccaaaagcatccaatttgaggggtgagtagt |
231 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
14308728 |
aatttttggataggaggataatccttctataatttgtctctttcccaaaagcatccaatttgaagggtaagtagt |
14308654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 210
Target Start/End: Original strand, 14438152 - 14438224
Alignment:
| Q |
139 |
aaagtttacat-cttgagaaatttttggacaggaggataatccttctataatttgtctctttcccaaaagcat |
210 |
Q |
| |
|
||||||||||| || ||||||| ||||||| ||||||||| ||||||||||||| ||| || ||||||||| |
|
|
| T |
14438152 |
aaagtttacatgctggagaaatccttggacaagaggataattcttctataatttgactccttttcaaaagcat |
14438224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University