View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14628_low_12 (Length: 201)
Name: NF14628_low_12
Description: NF14628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14628_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 3e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 3e-65
Query Start/End: Original strand, 35 - 172
Target Start/End: Complemental strand, 43664843 - 43664706
Alignment:
| Q |
35 |
gagagagaggaaaagataaaagataaaatactttaccaactttgatatatttgttattgtataattttagaaggaattgatgttgccatgcatgaaagag |
134 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || |
|
|
| T |
43664843 |
gagagagaggaaaagataaacgataaaatactttaccaactttgatatatttgttattgtataattttagaagaaattgatgttgccatgcatgaaatag |
43664744 |
T |
 |
| Q |
135 |
gacatgtgaattttacgatctccaaagatttctattag |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43664743 |
gacatgtgaattttacgatctccaaagatttctattag |
43664706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University