View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14629_high_33 (Length: 227)
Name: NF14629_high_33
Description: NF14629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14629_high_33 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 13139978 - 13140198
Alignment:
| Q |
7 |
tacacggctaaatttcaatgaatattttgatttatgtaatctttttaatttaaaatatcaaacttgaaatttaaattgtcttgatctcgatcaaacgacc |
106 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
13139978 |
tacacggctaaatttcaatgaagattttgatttatataatctttttaatttaaaatatcaaacttaaaatttaaattgtcttgatctcgatcaaacgacc |
13140077 |
T |
 |
| Q |
107 |
taaatatggttgactacttgaagtcgctgggttgtgaccgcatacaacccatattgccacatgatgttacaagaggttacattacatgatctatatactc |
206 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||||||||||||||||||||| |||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13140078 |
taaatatggttgactatttgaagtcgctggattgtgaccgcatacaacccatattaccaccttatgttacaagaggttacattacatgatctatatactc |
13140177 |
T |
 |
| Q |
207 |
ttagagagtaagttagtagca |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
13140178 |
ttagagagtaagttagtagca |
13140198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 78
Target Start/End: Complemental strand, 5521754 - 5521726
Alignment:
| Q |
50 |
tttaatttaaaatatcaaacttgaaattt |
78 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
5521754 |
tttaatttaaaatatcaaacttgaaattt |
5521726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University