View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14629_high_34 (Length: 224)
Name: NF14629_high_34
Description: NF14629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14629_high_34 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 14 - 210
Target Start/End: Complemental strand, 6667897 - 6667701
Alignment:
| Q |
14 |
ctttgttccttgcaaagcagaatttgttcactatctagcaaaaaggattcccgttgaagagaagtggcggtggttgcaaggagatgtggcaatggttgca |
113 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6667897 |
ctttgttccttacaaagcagaatttgttcactatctagcaaaaaggattcccgttgaagagaagtggcggtggttgcaaggagatgtggcagtggttgca |
6667798 |
T |
 |
| Q |
114 |
agcggtggtgtggctgtgaaaaccccatctgaatgaaagtgaaagatagggaataagaaattacgggaagggtaaaagtgagccaaattggtgaagg |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6667797 |
agcggtggtgtggctgtgaaaaccccatctgaatgaaagtgaaagatagggaataagaaattacgggaagggtaaaagtgagccaaattggtgaagg |
6667701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University