View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF14629_low_12 (Length: 402)
Name: NF14629_low_12
Description: NF14629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF14629_low_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 110; Significance: 3e-55; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 250 - 367
Target Start/End: Original strand, 39299562 - 39299679
Alignment:
| Q |
250 |
cccacattgaacctacatttccagcaccaggtacttttccttcacctcttgttcctaaatcctctgtttttcttcctttctcggccacaacttgtcctgt |
349 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
39299562 |
cccacatcgaacctacatttccagcaccaggtacttttccttcacctcttgttcctaaatcctctgtttttcttcctttctctgccacaacttgtcctgt |
39299661 |
T |
|
| Q |
350 |
tcccattcctctgttcat |
367 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
39299662 |
tcccattcctctgttcat |
39299679 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 52 - 159
Target Start/End: Original strand, 39299364 - 39299471
Alignment:
| Q |
52 |
gttcagcaccactttttcccaacattgcaccttcatttccagcacccgctcttcctctttgctcagctacactctttcccaagattacaccttcattttc |
151 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39299364 |
gttcagcagcactttttcccaacattgcaccttcatttccagcacccgctcttcctctttgctcagcaacactctttcccaagattacaccttcattttc |
39299463 |
T |
|
| Q |
152 |
accaccaa |
159 |
Q |
| |
|
|||||||| |
|
|
| T |
39299464 |
accaccaa |
39299471 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University